R E S E A R C H
Open Access
The effects of prenatal metformin on
obesogenic diet-induced alterations in
maternal and fetal fatty acid metabolism
Kemoy Harris
1,3
, Neeraj Desai
1,4
, Madhu Gupta
2,5
, Xiangying Xue
5
, Prodyot K. Chatterjee
5
, Burton Rochelson
1
and
Christine N. Metz
1,2,5*
Abstract
Background:Maternal obesity may program the fetus and increase the susceptibility of the offspring to adultdiseases. Metformin crosses the placenta and has been associated with decreased inflammation and reversal offatty liver in obese leptin-deficient mice. We investigated the effects of metformin on maternal and fetal lipidmetabolism and hepatic inflammation using a rat model of diet-induced obesity during pregnancy.
Methods:Female Wistar rats (6–7 weeks old) were fed normal or high calorie diets for 5 weeks. After mating withnormal-diet fed males, half of the high calorie-fed dams received metformin (300 mg/kg, daily); dams (8 per group)continued diets through gestational day 19. Maternal and fetal livers and fetal brains were analyzed for fatty acidsand for fatty acid metabolism-related gene expression. Data were analyzed by ANOVA followed by Dunnett’s posthoc testing.
Results:When compared to control-lean maternal livers, obesogenic-diet-exposed maternal livers showed significantlyhigher saturated fatty acids (14:0 and 16:0) and monounsaturated fatty acids (16:1n7 and 18:1n9) and lowerpolyunsaturated (18:2n6 and 20:4n6 [arachidonic acid]) and anti-inflammatory n3 polyunsaturated fatty acids(18:3n3 and 22:6n3 [docosahexaenoic acid]) (p< 0.05). Metformin did not affect diet-induced changes inmaternal livers. Fetal livers exposed to the high calorie diet showed significantly increased saturated fattyacids (18:0) and monounsaturated fatty acids (18:1n9 and 18:1n7) and decreased polyunsaturated fatty acids(18:2n6, 20:4n6 and 22:6n3) and anti-inflammatory n3 polyunsaturated fatty acids, along with increased geneexpression of fatty acid metabolism markers (Fasn,D5d,D6d,Scd1,Lxrα). Metformin significantly attenuated diet-inducedinflammation and 18:1n9 and 22:6n3 in fetal livers, as well as n3 fatty acids (p< 0.05). Prenatal obesogenic diet exposuresignificantly increased fetal liver IFNγlevels (p< 0.05), which was reversed by maternal metformin treatment (p< 0.05).
Conclusions:Consumption of a high calorie diet significantly affected maternal and fetal fatty acid metabolism. Itreduced anti-inflammatory polyunsaturated fatty acids in maternal and fetal livers, altered gene expression of fatty acidmetabolism markers, and induced inflammation in the fetal livers. Prenatal metformin attenuated some diet-inducedfatty acid changes and inflammation in the fetal livers without affecting maternal livers, suggesting that maternalmetformin may impact fetal/neonatal fatty acid/lipid metabolism.
Keywords:Fatty acid metabolism, Fetal programming, Metabolic syndrome, Pregnancy
Abbreviations:AA, Arachidonic acid; DHA, Docosahexaenoic acid; FA, Fatty acid; GD, Gestational day; GDM, Gestationaldiabetes mellitus; HCAL, High calorie; MUFA, Monounsaturated fatty acid; PUFA, Polyunsaturated fatty acid;
qPCR, Quantitative polymerase chain reaction; SFA, Saturated fatty acid
* Correspondence:cmetz@northwell.edu
1Hofstra Northwell School of Medicine, Department of OB/GYN, Division of
Maternal-Fetal Medicine, Manhasset, NY, USA
2Elmezzi Graduate School of Molecular Medicine, Manhasset, NY, USA
Full list of author information is available at the end of the article
Background
The prevalence of obesity and diabetes has increased in theUS and globally [1–3]. Data from 2013 to 2014 reveals thatover 40 % of women in the US are obese (BMI≥30) andover 9 % are morbidly obese (BMI≥40) –representing alinear increase since 2005 [4, 5]. Pregnancy itself is charac-terized by increased insulin resistance, which is more severein gestational diabetes mellitus (GDM). Maternal obesityand GDM, along with their accompanying metabolic/lipid,vascular, and inflammatory changes [6] are associated withan increased risk of poor pregnancy outcomes [7–9], aswell as an increased risk of type 2 diabetes [10, 11] and car-diovascular disease in the future [12, 13]. In addition, mater-nal obesity and aberrant glucose and lipid metabolism mayprogram the fetus for hepatic lipid dysfunction and may in-crease the susceptibility of the offspring to adult diseases/conditions, including metabolic syndrome-like phenotypeand poor vascular health [14–17].
In the US, insulin has been considered the standardtherapy for GDM [18]. Metformin, a biguanide drug thatpromotes glucose uptake and inhibits liver gluconeogen-esis, is increasingly being used during pregnancy, but isnot approved by the US Food and Drug Administrationfor use in GDM. In the absence of pregnancy, evidencefor improved lipid metabolism by metformin has beenaccumulating [19, 20]. In fact, metformin treatment re-versed fatty liver disease in obese leptin-deficient mice[21]. Because metformin crosses the placenta [22, 23]and thus, could impact both maternal and fetal metabol-ism, we investigated the effects of prenatal metformin ad-ministration on maternal and fetal lipid metabolism andhepatic inflammation using a rat model of diet-inducedobesity and metabolic syndrome during pregnancy.
Methods
Experimental animals
The Institutional Animal Care and Use Committee(IACUC) approved all animal studies prior to animalexperimentation (#2010-031). All animal experimenta-tion was performed in accordance with the PublicHealth Service (PHS) Policy on Humane Care and Useof Laboratory Animals and euthanasia complied withthe American Veterinary Medical Association (AVMA)Panel on Euthanasia. Female Wistar rats (6–7 weeksold, Taconic, Germantown, NY) were acclimatized withfree access to standard rat chow and water for at least 72 h.As previously described [24], rats were randomly assignedto one of twoad libitum diets: (1) a control rat chow ornormal-fed (NORM) or (2) a high calorie diet (HCAL, con-sisting of 33 % ground commercial rat chow, 33 % full fatsweetened condensed milk, 7 % sucrose, and 27 % water)shown to induce GDM and metabolic syndrome in rats[24, 25]. After 5 weeks, lean and acutely obese female rats(maintained on their respective diets) were mated with
normal-fed male Wistar rats (9–14 weeks old, Taconic).On gestation day 1 (GD1), one half of the dams fed thehigh calorie diet received metformin (300 mg/kg, p.o.daily). All dams (NORM,n= 8; HCAL,n= 8; HCAL + met-formin,n= 8) continued their respective diets throughoutgestation. On GD19 dams were euthanized by CO2inhal-ation followed by exsanguininhal-ation and livers were collected.Fetuses, delivered by cesarean section were euthanized bydecapitation and fetal livers and brains were collected. Ma-ternal livers, fetal livers and fetal brains were flash frozen inliquid nitrogen and stored at−80 °C.
Lipid and fatty acid (FA) profiling
Lipids were extracted from the maternal livers and fetallivers and brains according to the method of Folch–Lees[26]. Individual fatty acids (FAs) of the triglyceride frac-tions (maternal and fetal livers) or phospholipid fracfrac-tions(fetal brains) were quantified at the Lipid Core Laboratoryof Vanderbilt University’s Mouse Metabolic PhenotypingCenter (Grant #DK59637), as previously described [27].Total triglyceride-associated FAs of the maternal and fetallivers were normalized to liver weights (μg/mg); FA sub-sets and individuals FAs were expressed as percent of totalfraction (mg/100 mg triglyceride-fatty acids (maternal andfetal livers) or phospholipid fatty acids (fetal brains)).
Expression of markers of FA metabolism
Markers of FA synthesis and metabolism in maternaland fetal livers and fetal brains were assessed by quanti-tative polymerase chain reaction (qPCR) methods, aspreviously described [28]. RNA was isolated using theRNeasy® Plus Universal Mini kit with DNase treatment(Qiagen, Foster City, CA); RNA samples had 260/280and 260/230 ratios≥1.9. qPCR reactions were performed(in triplicate) using rat specific primers (designed usingthe Roche Universal Probe Library Design Center) andsynthesized by Eurofins (Huntsville, AL) for rat desaturaseand elongase-related genes:D5d,D6d,Scd1,Elovl1,Elovl2,Elovl5, andElovl6and other genes involved in FA synthe-sis: Chrebp (also known as Mlxipl), Lxra, Lxrb, Srebf1,and Fasn, using the Eurogentec One Step RT qPCR mas-termix (AnaSpec, Fremont, CA), 100 ng RNA, Roche Uni-versal Library probes (Indianapolis, IN) and the Roche480 Light Cycler, as previously described [29]. See Table 1for qPCR primers and probes. Changes in mRNA expres-sion (corrected using ratHprt1as the housekeeping gene)were calculated using the comparative Ct (ΔΔCt) method[30]. Data are presented as relative mRNA expression withthe normal-fed group set to 1.0.
Evaluation of cytokines and chemokines in maternal andfetal livers
Maternal and fetal livers were analyzed for multiple cy-tokines using the rat 9-plex pro-inflammatory panel
assay kit (Meso Scale Diagnostics [MSD], Rockville,MD), as previously described [31]. Liver hom*ogenateswere assayed for cytokines (IFNγ, IL-1β, IL-4, IL-5, IL-6,IL-10, IL-13, and TNFα) and chemokines (CXCL1,CXC-motif ligand 1) using the MSD multiplex platform.The raw data were measured as electrochemilumines-cence signals with the MSD Sector Imager 2400 platereader (Meso Scale Diagnostics, Rockville, MD) and ana-lyzed using the Discovery Workbench 3.0 software(MSD). The lower limits of detection for the analytes inthis assay were≤2 pg/ml, except for: IL-1β(7 pg/ml), IL-5 and IL-6 (14 pg/ml), and IL-10 (20 pg/ml). The R2value for each standard curve was between 0.99 and 1.0.Samples being compared were run on the same plateand the % coefficient of variation of control replicatesrun on the same plate was between 2.3 % (TNFα) and5.7 % (IFNγ). Liver cytokine data were corrected for pro-tein concentration (Bio-Rad propro-tein assay, Bio-Rad,Hercules, CA) and expressed as pg/g.
Western blotting
ChREBP and SREBP-1 protein expression in maternal andfetal livers was assessed by western blotting. Liver tissues(100 mg) were hom*ogenized as described above. Proteins
(40 μg/lane, determined by BioRad protein assay) wereseparated by electrophoresis using Nu-PAGE® gels (LifeTechnologies, Grand Island, NY) and transferred toPVDF membranes (Millipore). The blots were probedwith anti-SREBP-1 (Santa Cruz Biotechnology, Dallas TX),ChREBP (Novus Biologicals, Littleton, CO), and anti-GAPDH (Cell Signaling Technology, Danvers, MA, USA)antibodies, followed by near infrared-fluorescently labeledsecondary antibodies (LI-COR, diluted 1:15,000), and re-vealed using the Odyssey infrared imaging system (LI-COR Biosciences), as previously described [28, 32]. Banddensities (SREBP-1: GAPDH and ChREBP:GAPDH) wereassessed using Image J software (NIH).
Statistics
Data were analyzed using one-way ANOVAs for mul-tiple comparisons followed by Dunnett’s post-hoctesting using GraphPad Prism 5.03 (GraphPad Soft-ware, San Diego, CA). P values <0.05 were consid-ered significant.
Results
High calorie diet alters maternal liver lipid profiles: noeffect of metformin
Livers obtained from the HCAL-fed dams showed a 40 %increase in total triglyceride-associated FAs vs. control damlivers, irrespective of metformin treatment (Fig. 1a,p< 0.05).Furthermore, maternal livers showed numerous HCAL-dietrelated changes in their FA profiles; HCAL-exposed livershad significantly higher saturated fatty acids (SFAs) (Fig. 1b,p< 0.05) and monounsaturated fatty acids (MUFAs) (Fig. 1c,p< 0.001) and lower polyunsaturated fatty acids (PUFAs)(Fig. 1d, p< 0.001), as well as a 3-fold lower expression ofanti-inflammatory n3 FAs compared to control-fed dams(Fig. 1e,p< 0.001). More specifically, maternal HCAL livershad significantly higher 14:0, 16:0, 16:1n7, and 18:1n9FAs and significantly lower 18:2n6, 18:3n3, 20:4n6 (ara-chidonic acid, AA) and 22:6n3 (docosahexaenoic acid,DHA) FAs, when compared to livers obtained fromcontrol-fed dams (Table 2). Maternal metformin treat-ment did not affect HCAL-diet-induced triglyceride-FAlevels or FA-related changes in the maternal livers(Fig. 1a-e and Table 2).
Maternal obesogenic diet affects markers of lipidmetabolism in maternal livers
Srebf1 mRNA expression was significantly induced inthe maternal livers following HCAL diet exposure(Table 3, p< 0.001). However, maternal metformin ad-ministration did not alter HCAL-induced Srebf1mRNAexpression in the maternal livers (Table 3). There wereno significant changes in the mRNA expression of othermarkers of lipid synthesis/metabolism analyzed (Chrebp,Lxrα/β, Srebf1, and Fasn, as well as various elongases
Table 1qPCR primers used to assess gene expression of markersof lipid/fatty acid metabolism
Gene Primer Sequence 5′_3′ Accession numbera
(Probe number)Chrebp ForwardReverseAATCCCAGCCCCTACACCCTGGGAGGAGCCAATGTGNM_133552.1 (10)D5d ForwardReverseGAACTCTCTTCTGATTGGAGAGCTACCGGAATTCATCAGTGAGCAB052085.1 (26)D6d ForwardReverseAATTTCCAGATTGAGCACCACAGTGGGGCAATCTTGTGCNM_031344.2 (60)D9d ForwardReverseGAAGCGAGCAACCGACAGGGTGGTCGTGTAGGAACTGGNM_139192.2 (125)Elovl2 ForwardReverseAACCTCGGAATCACACTTCTTTTCCCAGCTGGAGAGAACGNM_001109118.1 (22)Elovl5 ForwardReverseTCGATGCGTCACTCAGTACCCCTTTGACTCGTGTGTCTCGNM_134382.1 (122)Elovl6 ForwardReverseATGGATGCAGGAAAACTGGAGCCCGCTTGTTCATCAGANM_134383.2 (119)Fasn ForwardReverseGGCCACCTCAGTCCTGTTATAGGGTCCAGCTAGAGGGTACANM_017332.1 (6)
Lxrα ForwardReverse
CAGGAAGAGATGTCCTTGTGGTCTTCCACAACTCCGTTGC
NM_031627.2 (2)
Lxrβ ForwardReverseAGCTCTGCCTACATCGTGGTGACCCTTCTTCCGCTTGCNM_031626.1 (106)Srebf ForwardReverseACAAGATTGTGGAGCTCAAGGTGCGCAAGACAGCAGATTTANM_001276707.1 (77)
Forward and reverse primers for rat genes with GenBank Accession numbersand specific Roche Universal Probe numbers used for assessing mRNAexpression in rat tissues by qPCR
a
(Elovl2,5, or6) and desaturases (D5d,D6d,D9d [Scd1])) inthe maternal livers following the HCAL diet (±metformin)(Table 3). Next, we confirmed the increased expression ofSREBP-1 protein in maternal livers following HCAL dietexposure when compared to controls (Fig. 2a and b,p< 0.001); the increased SREBP-1 protein expressionwas partially attenuated by metformin administration(Fig. 2a and b, p< 0.05). By contrast, maternal liverChREBP protein expression was unaffected by HCAL-diet exposure (± metformin) (Fig. 2a and b).
HCAL diet prior to and during pregnancy did notpromote cytokine production in maternal livers
Based on the link between hepatic liver lipid accumulationand inflammation, we assessed maternal livers obtainedfrom control-fed and HCAL-fed (±metformin) dams fornumerous cytokines. We found no effect of the HCALdiet (with or without metformin) on localized hepatic in-flammation, as determined by measuring IL-1β, IL-4, IL-5,IL-6, IL-10, IL-13, IFNγ, TNFα, and CXCL1 concentra-tions in the maternal livers (Additional file 1: Table S1).
Fig. 1HCAL diet increases triglyceride deposition in the maternal liver and alters maternal liver lipid profiles. No effect of metformin. Dams were
fed a normal (NORM) or a high calorie (HCAL) diet prior to and during pregnancy ± metformin (MET), as described in the Methods. Maternal livertotal triglyceride-associated FA (TG-FA) concentrations were determined on GD19 (a). Saturated fatty acids (SFA,b), monounsaturated FA (MUFA,
c), polyunsaturated FA (PUFA,d), and n3 fatty acids (n3FA,e) profiles of the maternal livers were determined on GD19. Data are shown as mean± SD. *p< 0.05; **p< 0.01; ***p< 0.001
Table 2HCAL diet affects maternal liver fatty acid profiles. Noeffect of metformin
Fatty acid NORM mean(±SD)
HCAL mean(±SD)
HCAL + METmean (±SD)
SFA 14.0 0.6 (±0.14) 1.3 (±0.24)a** 1.2 (±0.20)
16.0 28.5 (±1.90) 32.7 (±2.35)a* 33.4 (±2.25)
18.0 6.7 (±0.44) 6.3 (±1.89) 6.5 (±0.60)
MUFA 16.1n7 2.1 (±0.47) 4.2 (±0.89)a* 3.7 (±0.47)
18.1n9 33.2 (±1.43) 41.4 (±1.04)a* 41.3 (±1.79)
18.1n7 4.1 (±0.29) 4.4 (±0.44) 4.2 (±0.74)
PUFA 18.2n6 19.5 (±2.60) 8.3 (±1.41)a* 8.1 (±1.10)
18.3n3 0.8 (±0.10) 0.3 (±0.19)a* 0.2 (±0.21)
20.4n6 2.6 (±0.74) 1.1 (±0.34)a* 1.1 (±0.39)
22.6n3 1.6 (±0.63) 0.3 (±0.23)a* 0.2 (±0.22)NORMnormal diet,HCALhigh calorie diet,METmetformin,SDstandarddeviation,SFAsaturated fatty acids,MUFAmonounsaturated fatty acids,PUFApolyunsaturated fatty acids
aNORM vs. HCAL; *p< 0.05, **p
< 0.01Data are expressed as mean ± SD (mg/100 mg)
Fetal exposure to maternal obesity significantly altersfetal hepatic FA profile; metformin reverses some ofthese effects
Although in utero exposure to the HCAL diet did notsignificantly change the total triglyceride-associated FAcontent of the fetal livers on embryonic day 19 (Fig. 3a),it significantly increased SFAs (Fig. 3b, p< 0.01) andMUFAs (Fig. 3c, p< 0.001), and significantly decreasedPUFAs (Fig. 3d, p< 0.001), as well as anti-inflammatoryn3 FAs when compared to control fetal livers (Fig. 3e,p< 0.001). More specifically, livers obtained from HCALdiet-exposed fetuses showed significantly increased 18:0,18:1n9, and 18:1n7 and significantly reduced 18:2n6, 20:4n6(AA), and 22:6n3 (DHA) (Table 4). While no changes inmaternal hepatic FA profiles were observed following met-formin administration (Fig. 1b–e and Table 2), significantchanges in diet-induced FA changes in the fetal livers wereobserved following maternal metformin treatment. HCAL-induced overall MUFAs (Fig. 3c, p< 0.001), specifically18:1n9, were significantly attenuated by maternal met-formin administration (Table 4, p< 0.01), while HCAL-induced 18:1n7 was only slightly reduced (not significant)(Table 4). Maternal metformin blocked HCAL-reduced22:6n3 (DHA) in fetal livers following HCAL-exposure(Table 4, p< 0.05). Similarly, HCAL-suppressed n3 FAlevels in the fetal livers were reversed by maternal metfor-min treatment (Fig. 3e,p< 0.001).
In utero exposure to maternal high calorie diet altersmarkers of lipid metabolism in fetal livers
Fetal exposure to the maternal HCAL-diet significantlyincreased the expression of several genes shown to beinvolved in fatty acid metabolism in the fetal livers, in-cluding D5d, D6d, D9d[Scd1],Fasn, andLxrα(Table 3).
In uterometformin exposure did not significantly attenu-ate these effects; however, metformin slightly (not signifi-cantly) reduced the effects of HCAL diet exposure onD5dand D9d (Scd1) mRNA expression in fetal livers whenassessed on embryonic day 19 (Table 3). Western blottingof fetal livers confirmed that neither SREBP-1 norChREBP protein expression was affected by HCAL diet(with or without metformin) (Fig. 4a–b).
In utero exposure to maternal obesogenic dietsignificantly affects fetal brain FA profiles
While fetal brains had no significant differences in over-all phospholipid-associated SFA, MUFA, PUFA, or n3FA concentrations following HCAL-diet exposure whencompared to controls (Fig. 5a–d), HCAL diet-exposedfetal brains had significantly reduced 20:4n6 (AA), 22:4n6,and 22:5n6 and significantly increased 22:6n3 (DHA) con-centrations when compared to controls (Table 5). Withthe exception of HCAL-reduced 22:5n6 in the fetal brains,which was reversed by maternal metformin treatment(p< 0.05), no other changes were observed following ma-ternal metformin administration (Table 5). Fetal exposureto the HCAL-diet reducedD9d(Scd1) mRNA expressionin the fetal brains (Table 6,p< 0.05), but maternal metfor-min had no effect on D9d (Scd1) mRNA expression(Table 6).
Prenatal exposure to metformin reduces HCAL diet-induced IFNγlevels in fetal livers
Although no effect of the HCAL diet was found on ma-ternal liver inflammation, as assessed by measuring vari-ous cytokines and chemokines (see Additional file 1:Table S1), in uteroexposure to the maternal obesogenicdiet significantly increased IFNγ concentrations in the
Table 3The effects of high calorie diet (± metformin) on gene expression in maternal and fetal livers
Maternal livers Fetal Livers
Gene NORM mean (±SD) HCAL mean (±SD) HCAL + MET mean (±SD) NORM mean (±SD) HCAL mean (±SD) HCAL + MET mean (±SD)
Chrebp 1.0 (±0.33) 0.9 (±0.19) 1.1 (±0.41) 1.0 (±0.25) 1.1 (±0.34) 0.9 (±0.46)D5d 1.0 (±0.36) 1.2 (±0.23) 1.4 (±0.27) 1.0 (±0.34) 1.5 (±0.44)a* 1.4 (±0.34)
D6d 1.0 (±0.49) 1.1 (±0.33) 1.5 (±0.26) 1.0 (±0.31) 1.5 (±0.23)a*** 1.6 (±0.26)
D9d (Scd1) 1.0 (±0.68) 1.2 (±0.35) 1.3 (±0.33) 1.0 (±0.33) 1.4 (±0.37)a* 1.2 (±0.28)
Elovl2 1.0 (±0.39) 0.9 (±0.24) 0.8 (±0.13) 1.0 (±0.23) 1.1 (±0.30) 1.0 (±0.32)Elovl5 1.0 (±0.14) 1.0 (±0.24) 1.1 (±0.06) 1.0 (±0.12) 1.5 (±0.86) 1.1 (±0.18)Elovl6 1.0 (±0.37) 0.8 (±0.26) 1.0 (±0.43) 1.0 (±0.15) 1.1 (±0.16) 1.3 (±0.25)Fasn 1.0 (±0.46) 1.0 (±0.47) 1.1 (±0.39) 1.0 (±0.18) 1.5 (±0.28)a*** 1.6 (±0.37)
Lxrα 1.0 (±0.13) 1.0 (±0.09) 1.1 (±0.14) 1.0 (±0.13) 1.2 (±0.30)a** 1.3 (±0.30)
Lxrβ 1.0 (±0.42) 1.0 (±0.11) 1.0 (±0.13) 1.0 (±0.13) 1.0 (±0.14) 1.0 (±0.13)Srebf1 1.0 (±0.29) 1.8 (±0.36)a*** 1.7 (±0.38) 1.0 (±0.23) 1.3 (±0.40) 1.2 (±0.19)
NORMnormal diet,HCALhigh calorie diet,METmetformin,SDstandard deviation
aNORM vs. HCAL; *p= <0.05; **p< 0.01, ***p
< 0.001
fetal livers (Fig. 6 and Additional file 1: Table S1). Thiseffect was attenuated by prenatal metformin exposure(Fig. 6 and Additional file 1: Table S1).
Discussion
Obesity in pregnant women is accompanied by dyslipid-emia, characterized by elevated triglyceride levels [6].Consumption of the HCAL diet enriched in saturatedfats and sugar by pregnant rats significantly increasedtotal triglycerides and increased proportion of SFAs, andMUFAs, and decreased PUFAs and n3 FAs in maternalrat livers (Fig. 1 and Table 2). The most notable changes inthe maternal livers were the >2-fold decline in PUFAs(Fig. 1d) and the 3-fold decline in anti-inflammatory n3FAs (Fig. 1e). These changes might be detrimental, as ma-ternal PUFAs are essential for healthy fetal development,including the fetal brain [33] and because n3 FAs have beenproposed to regulate fetal brain development [34] and im-prove insulin resistance during pregnancy [35]. Likewise,the accumulation of the end product of de novo lipogen-esis, 18:1n9 (oleic acid), was significantly higher in theHCAL-exposed maternal livers when compared to controlmaternal livers (Table 2). These changes, indicative of liverdysfunction and enhanced de novo lipogenesis, were ac-companied by elevatedSrebfmRNA expression (almost 2-fold, Table 3) and increased SREBP-1 protein (Fig. 2a–b) in
the maternal livers following the obesogenic diet. SREBP-1serves as one of the major regulators of de novo lipogen-esis/fatty acid synthesis by activating genes required forlipogenesis [36, 37]. In fact, overexpression of SREBP-1 intransgenic mice produced fatty livers via excess de novolipogenesis [38]. Hepatic triglyceride deposition and meta-bolic syndrome have been strongly associated with insulinresistance [39, 40]. Both insulin and glucose are the majorinducers ofSrebfmRNA expression, and thus, these resultsare consistent with previous studies showing that this obe-sogenic diet induces GDM [25] and metabolic syndrome,as determined by increased maternal circulating insulin,leptin, and triglyceride levels [24].
Maternal obesity and metabolic syndrome can lead toadverse fetal outcomes, including structural anomalies andfetal liver lipotoxicity [41, 42]. Fetal exposure to excess ma-ternal lipids and their metabolites are proposed to triggersignaling pathways in developing organs, including theliver, adipose, skeletal muscle, and brain, that lead to short-and long-term metabolic consequences (e.g., energy stor-age, cell differentiation, cell death, and inflammation)(Reviewed in [41]). We found thatin uteroHCAL expos-ure did not affect total triglyceride-associated fatty acids inthe fetal livers, but it significantly increased the proportionof SFAs and MUFAs, decreased PUFAs and n3 FAs(Fig. 3b–e and Table 4), and elevated IFNγ in the fetal
Fig. 2SREBP-1 protein in the maternal liver is increased by the HCAL diet. Maternal livers obtained from dams after feeding normal (NORM) or high
calorie (HCAL) diets (±metformin, MET) were examined on GD19 for SREBP-1 and ChREBP protein expression by western blotting (a). Quantitationof SREBP-1 and ChREBP bands normalized for GAPDH expression (SREBP-1:GAPDH and ChREBP:GAPDH) is shown inb. Data are shown as mean ±SD. *p< 0.05; ***p< 0.001
Table 4HCAL diet (±metformin) exposure alters FA profiles of fetal livers
Fatty acid NORM mean (±SD) HCAL mean (±SD) HCAL + MET mean (±SD)
SFA 14.0 2.1 (±0.18) 2.2 (±0.27) 2.1 (±0.23)
16.0 23.9 (±0.96) 25.6 (±1.57) 25.4 (±1.94)
18.0 7.18 (±0.73) 8.8 (±0.87)a*** 9.2 (±0.76)
MUFA 16.1n7 4.3 (±0.45) 4.6 (±0.46) 3.9 (±0.29)
18.1n9 34.2 (±1.56) 38.8 (±2.08)a** 35.9 (±2.26)b**
18.1n7 3.6 (±0.28) 4.4 (±0.20)a*** 4.2 (±0.17)
PUFA 18.2n6 14.4 (±2.1) 8.8 (±1.70)a*** 10.1 (±0.92)
18.3n6 0.5 (±0.26) 0.4 (±0.21) 0.22 (±0.28)
20.4n6 2.2 (±0.69) 1.4 (±0.43)a* 1.7 (±0.31)
22.6n3 6.8 (±1.02) 5.0 (±1.76)a* 7.0 (±1.21)b*
NORMnormal diet,HCALhigh calorie diet,METmetformin,SDstandard deviation,SFAsaturated fatty acids,MUFAmonounsaturated fatty acids,PUFApolyunsaturated fatty acids
a
NORM vs. HCAL,bHCAL vs. HCAL + MET; *p< 0.05, **p< 0.01, ***p
< 0.001Data are expressed as mean ± SD (mg/100 mg)
Fig. 3HCAL diet exposure alters fetal liver fatty acid profiles. Modifications by in utero metformin exposure. Fetuses were exposed to either a normal
Fig. 4SREBP-1 and ChREBP protein expression in the fetal livers are unaffected by exposure to the HCAL diet. No effect of metformin. Fetal livers wereexamined for SREBP-1 and ChREBP protein expression by western blotting (a). Quantitation of SREBP-1 and ChREBP bands normalized for GAPDHexpression (SREBP-1:GAPDH and ChREBP:GAPDH) are shown inb
Fig. 5Effect of HCAL diet exposure on fetal brain fatty acid profiles. No effect of metformin. Fetuses were exposed to either a normal (NORM) or a
high calorie (HCAL) maternal diet (±metformin, MET), as described in the Methods. The saturated fatty acids (SFA,a), monounsaturated FA (MUFA,
b), polyunsaturated FA (PUFA,c), and n3 FA (d) profiles of the fetal brains were determined on embryonic day 19. Data are shown as mean ± SD
livers (Fig. 6). IFNγ, previously shown to accompany hep-atic steatosis in mice [43], may directly induce endoplas-mic reticulum stress, a potential contributor to the viciouscycle of obesity and chronic inflammation [35]. HCALdiet-exposed fetal livers showed enhancedLxramRNA ex-pression (Table 3).Lxrαis considered the master regulatorof hepatic lipogenesis; it induces Fasn [36, 37]. We ob-served enhancedFasn,D5d,D6d, andD9dmRNA expres-sion in the HCAL-exposed fetal livers (Table 3), consistentwith previous studies showing altered FA metabolism andlipid accumulation in the fetal livers of non-human pri-mates following exposure to a chronic maternal high fatdiet [42].
Aberrant FA profiles found in the fetal brains follow-ing in utero HCAL-diet exposure (decreased 20:4n6,
22:4n6, and 22:5n6 (PUFAs), Table 5) were consistentwith decreased PUFAs in the maternal and fetal livers(Figs. 1 and 3, Tables 2 and 4). Surprisingly, fetal brainsexposed to the HCAL diet showed increased 22:6n3(DHA) (Table 5). DHA, which is primarily obtained viatransplacental transport from the maternal side, is critic-ally important for fetal brain development [33]. Maternalliver DHA levels were more reduced by the HCAL dietwhen compared to those in the fetal liver. Thus, the ob-served increase in fetal brain DHA levels may representa fetal compensatory mechanism to obtain DHA fromthe maternal compartment to protect the fetal brain des-pite reduced DHA availability and reduced fetal liverDHA levels.
Table 5Effects of maternal HCAL diet (±metformin) on fetal brain FA profiles
Fatty acid NORM mean (±SD) HCAL mean (±SD) HCAL + MET mean (±SD)
SFA 14.0 1.9 (±0.08) 2.0 (±0.05) 2.0 (±0.23)
16.0 33.4 (±0.89) 33.6 (±0.93) 32.8 (±0.27)
18.0 17.8 (±0.81) 17.5 (±0.52) 16.9 (±0.30)
MUFA 16.1n7 2.2 (±0.21) 2.2 (±0.10) 2.3 (±0.12)
18.1n9 13.6 (±0.56) 13.9 (±0.30) 14.3 (±0.39)
18.1n7 3.9 (±0.19) 3.9 (±0.26) 4.0 (±0.21)
PUFA 20.4n6 13.2 (±0.42) 12.5 (±0.35)a* 13.0 (±0.41)
22.4n6 3.2 (±0.12) 2.9 (±0.03)a** 3.0 (±0.17)
22.5n6 2.9 (±0.24) 2.3 (±0.22)a** 2.7 (±0.22)b*
22.6n3 7.0 (±0.75) 8.6 (±1.53)a* 8.0 (±0.35)
NORMnormal diet,HCALhigh calorie diet,METmetformin,SDstandard deviation,SFAsaturated fatty acids,MUFAmonounsaturated fatty acids,PUFApolyunsaturated fatty acids
a
NORM vs. HCAL,bHCAL vs. HCAL + MET; *p< 0.05, **p
< 0.01Data are expressed as mean ± SD (mg/100 mg)
Table 6The effects of HCAL diet (± metformin) on geneexpression in fetal brains
Gene NORM mean(±SD)
HCAL mean(±SD)
HCAL + METmean (±SD)
Chrebp ND ND ND
D5d 1.0 (±0.14) 0.9 (±0.13) 1.0 (±0.19)D6d 1.0 (±0.06) 0.9 (±0.12) 1.1 (±0.09)D9d (Scd1) 1.0 (±0.06) 0.9 (±0.11)a*** 0.8 (±0.05)Elovl2 1.0 (±0.10) 1.4 (±0.42) 1.5 (±0.08)Elovl5 1.0 (±0.20) 1.0 (±0.14) 1.0 (±0.10)Elovl6 1.0 (±0.15) 0.9 (±0.17) 1.1 (±0.16)Fasn 1.0 (±0.13) 1.0 (±0.07) 1.0 (±0.10)Lxrα 1.0 (±0.01) 1.2 (±0.07) 1.4 (±0.29)Lxrβ 1.0 (±0.19) 0.9 (±0.09) 0.8 (±0.22)Srebf1 1.0 (±0.14) 1.1 (±0.23) 1.0 (±0.27)NORMnormal diet,HCALhigh calorie diet,METmetformin,SDstandard deviation
a
NORM vs. HCAL; ***p< 0.001
Data are presented as relative mRNA expression (mean ± SD), with the normal-fedgroup set to 1.0
Fig. 6Intrauterine exposure to HCAL diet increases fetal liver IFNγ
levels. Metformin attenuates enhanced IFNγlevels in fetal livers. Fetallivers were obtained following exposure to maternal normal (NORM) orhigh calorie (HCAL) diets (±metformin, MET) on embryonic day 19 andIFNγlevels were assessed and adjusted for fetal liver protein
Aberrant liver lipid metabolism and fatty liver diseaseare significant contributors to the morbidity and mortal-ity associated with obesmortal-ity-related diabetes [44]. Treatinggestational diabetics through diet modification, exercise,and drugs (e.g., insulin and oral anti-diabetic agents, in-cluding metformin) improves maternal, fetal/neonatal,and offspring outcomes [45]. In the non-pregnant state,metformin enhances glucose regulation and lipid metab-olism in obese women [19, 46] and diabetic/hyperinsuli-nemic rodents [20, 47]. Although it has been safely usedfor treating GDM in other countries since the 1970s[48], metformin has only been regularly prescribed towomen with GDM in the US within recent years [49].Similarly, treatment of GDM with metformin has re-cently increased in Norway, Wales, and the rest of theUK [50]. Evidence from randomized controlled trialsand observational studies revealing no adverse maternalor fetal/neonatal effects in the short-term [51, 52] sup-ports using metformin for GDM [18]. The 2013 MiGtrial comparing insulin vs. metformin for treating gesta-tional diabetics confirmed the safety of metformin inpregnancy and revealed no differences in either maternalcirculating hormones/metabolites, birth weight, or neo-natal anthropometric measurements between the twotreatments [53]. The results of the MiG trial showedonly subtle effects of metformin on maternal lipid pa-rameters associated with cardiovascular risk and no ef-fects on cord blood (fetal) lipids [53]. However, invasiveantenatal lipid analyses, as reported herein, were notperformed.
Metformin improves hepatic lipid metabolism [19, 20].In the non-pregnant state, metformin reverses fatty liverdisease in obese leptin-deficient mice [21], blocks hepaticsteatosis, liver inflammation, and fibrosis in a non-diabeticnonalcoholic steatohepatitis (NASH) mouse model [54],and counter-regulates diet-induced SREBP-1 and fattyacid synthase (FASN) protein expression in a mousemodel [55]. Although maternal metformin administrationreversed HCAL diet-induced SREBP-1 protein expressionin maternal livers (Fig. 2), it had no effect on HCAL-induced hepatic (total) triglyceride-associated FA levels(Fig. 1a), fatty acid profile changes (Fig. 1b-e and Table 2)or FA-related gene expression in maternal livers (Table 3).In fact, metformin slightly increased total triglyceride-associated FA levels in the maternal rat liver, a finding thatis consistent with the reported increase in circulating tri-glyceride levels and atherogenic plasma values in womenwith GDM who were treated with metformin vs. insulinlater in pregnancy [56]. These results suggest potentiallydifferential regulation of FA metabolism by metformin inthe pregnant and non-pregnant states. Alternatively, inour study HCAL diet-induced changes in the maternalliver might not have been significant enough to be modi-fied by metformin, a higher dose of metformin might be
required in pregnancy, or the duration of metformin treat-ment was too short to observe measurable changes. How-ever, this same HCAL diet regimen induced both GDM[25] and hyperinsulinemia [24] in pregnant rats.
Prenatal metformin exposure may affect the fetal com-partment and lead to long-term programming effects onfetal metabolism [57], which may be positive. We andothers have shown that maternal metformin exerts anti-inflammatory effects [24, 54, 58, 59], including the re-duction of cytokines/chemokines in the fetal plasma andamniotic fluid in a rat model of diet-induced obesity/metabolic syndrome [24]. Although we did not observesignificant HCAL-induced maternal liver-associated in-flammation, elevated IFNγconcentrations were found inthe fetal livers, and these were attenuated by maternalmetformin administration (Fig. 6). Consistent with the fetalprogramming effects of metformin,in uterometformin ex-posure reversed diet-induced overall MUFA (Fig. 3c), aswell as HCAL-diet reduced n3 FA (Fig. 3e), 18:1n9 (oleicacid) levels, and 22:6n3 (DHA) levels in fetal livers (Table 4).Although not significant, metformin slightly attenuatedHCAL-induced D5d and D9d mRNA expression in thefetal livers (Table 3). By contrast, except for 22:5n6 (a minorphospholipid-fatty acid in the brain), in utero metforminexposure had no effects on diet-induced FA changes in thefetal brains (Table 5).
Our data show significant effects of maternal obesogenic-diet exposure and metformin treatment during metabolicsyndrome in pregnancy on FA composition and FA metab-olism in the fetal compartment. However, this study hasseveral limitations. Methodologically, the high calorie dietwas provided only 5 weeks prior to pregnancy and through-out pregnancy (3 weeks) and thus, represents‘acute diet-induced obesity’. A longer HCAL diet-feeding period mightbetter reflect the chronic obesity observed in humans. Be-cause the normal and HCAL diets (± metformin) were pro-vided ad libitum we were unable to assess exact intakes.Also, maternal metformin treatment was modeled after ro-dent studies performed in the absence of pregnancy. Per-haps higher doses of metformin are required duringpregnancy. Finally, these findings are difficult to extrapolateto humans, which is true for all studies using laboratoryanimals. Nevertheless, this model may provide us witha better understanding of the pathophysiological changesobserved with maternal obesity/metabolic syndrome andthe use of metformin for obesity-related metabolic syn-drome during pregnancy.
It is important to note that maternal metformin treat-ment in humans does not compromise neurodeveloptreat-mentaloutcomes when measured in two year old children [60, 61].Our results show that metformin promotes preservation offetal DHA (despite reduced maternal liver DHA) importantfor fetal/neonatal brain development. Recent studies by Sal-omaki and co-workers revealed that the fetal liver is an
important target of maternal metformin and that protectiveeffects on offspring were observed when dams were ex-posed to a high fat diet (vs. normal diet) prior to/duringmetformin treatment [57, 62]. Our study differs in that ahigh fat, high sugar diet was administered to dams (priorto/during metformin treatment) rather than a regular diet[57] or a high fat diet [62]; the high fat, high sugar diet waschosen to better reflect the Western diet. Although ourstudy was not designed to investigate the effects of a mater-nal high calorie diet (±metformin) on long-term offspringoutcomes, the data support the potential fetal programmingeffects of maternal obesity via changes in fetal fatty acidprofiles and fetal liver IFNγconcentrations, with reversal bymaternal metformin administration. Both GDM and adultobesity are increasing [3, 4, 63] and thus, represent wide-spread problems with potentially serious implications formothers and their offspring. Therefore, future studies willfocus on investigating the effects of metformin and otheranti-diabetic and/or lipid normalizing strategies in the set-ting of obesity/metabolic syndrome during pregnancy onneonatal complications and long-term adverse metabolicconsequences in the offspring. These studies would facilitatethe development of interventions to mitigate the adverse ef-fects of maternal obesity and metabolic syndrome on off-spring health in the short- and long-terms.
Conclusions
Obesogenic diet consumption by pregnant mice led tochanges in the fatty acid composition of maternal and fetallivers, including reductions in healthy PUFAs and anti-inflammatory n3 FAs. In utero HCAL diet exposure in-creased liver IFNγconcentrations without affecting mater-nal liver IFNγconcentrations. While maternal metformintreatment did not significantly alter diet-induced maternalliver fatty acid changes, fetal exposure to metformin atten-uated diet-induced changes in fetal liver DHA levels, anti-inflammatory n3FAs and liver IFNγconcentrations. Thus,maternal metformin might be beneficial for fetal/neonataloutcomes in the setting of maternal obesity and/or meta-bolic syndrome.
Additional file
Additional file 1: Table S1.Cytokine and chemokine profiles in maternal
and fetal livers following normal and high calorie diets (±metformin).(DOCX 21 kb)
Acknowledgements
The assistance of the staff of the Center for Comparative Physiology fortaking care of the animals is acknowledged.
Funding
Research supported by The Feinstein Institute for Medical Research and TheKatz Institute for Women’s Health.
Availability of data and materials
The datasets supporting the conclusions of this article are included withinthe article and within the additional file. Please note: Data from thismanuscript was presented, in part, at the 62ndAnnual Meeting of theSociety for Reproductive Investigation (SRI) on March 27, 2015.
Authors’contributions
The present research was supported by the Feinstein Institute for MedicalResearch and the Katz Institute for Women’s Health, Northwell Health. KH,ND, BR, and CNM designed and directed the study; ND, XX, MG, and CNMconducted the animal trial; KH, XX, MG, and PKC performed qPCR, MSD assays,and western blot analyses; and KH and CNM performed the statistical analysis.All the authors participated in drafting and finalizing the manuscript. All authorsread and approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.
Consent for publication
All authors have reviewed the submitted manuscript and agree with itsreview and publication inNutrition & Metabolism.
Ethics approval and consent to participate
All animal experimentation was performed in accordance with the PublicHealth Service (PHS) Policy on Humane Care and Use of Laboratory Animalsand euthanasia complied with the American Veterinary Medical Association(AVMA) Panel on Euthanasia. There was no consent to participate as nohuman subjects were involved in this study.
Author details
1Hofstra Northwell School of Medicine, Department of OB/GYN, Division of
Maternal-Fetal Medicine, Manhasset, NY, USA.2Elmezzi Graduate School of
Molecular Medicine, Manhasset, NY, USA.3Present Address: Jamaica Hospital
Medical Center, Medisys Health Network, Jamaica, NY, USA.4Winnie PalmerHospital-Orlando Health, Orlando, FL, USA.5The Feinstein Institute for
Medical Research, The Center for Biomedical Sciences, Northwell Health, 350Community Drive, Manhasset, NY 11030, USA.
Received: 29 June 2016 Accepted: 13 August 2016
References
1. Ogden CL, Carroll MD, Kit BK, Flegal KM. Prevalence of obesity in the UnitedStates, 2009–2010. NCHS Data Brief. 2012;1–8
2. Danaei G, Finucane MM, Lu Y, Singh GM, Cowan MJ, Paciorek CJ, Lin JK,Farzadfar F, Khang YH, Stevens GA, Rao M, Ali MK, Riley LM, Robinson CA,Ezzati M. National, regional, and global trends in fasting plasma glucose anddiabetes prevalence since 1980. systematic analysis of health examinationsurveys and epidemiological studies with 370 country-years and 2.7 millionparticipants. Lancet. 2011;378:31–40.
3. Finucane MM, Stevens GA, Cowan MJ, Danaei G, Lin JK, Paciorek CJ, SinghGM, Gutierrez HR, Lu Y, Bahalim AN, Farzadfar F, Riley LM, Ezzati M. National,regional, and global trends in body-mass index since 1980: systematic analysisof health examination surveys and epidemiological studies with 960 country-years and 9.1 million participants. Lancet. 2011;377:557–67.
4. Flegal KM, Kruszon-Moran D, Carroll MD, Fryar CD, Ogden CL. Trends in obesityamong adults in the United States, 2005 to 2014. JAMA. 2016;315:2284–91.5. Ogden CL, Carroll MD, Lawman HG, Fryar CD, Kruszon-Moran D, Kit BK,
Flegal KM. Trends in obesity prevalence among children and adolescents inthe United States, 1988–1994 through 2013–2014. JAMA. 2016;315:2292–9.6. Ramsay JE, Ferrell WR, Crawford L, Wallace AM, Greer IA, Sattar N. Maternal
obesity is associated with dysregulation of metabolic, vascular, andinflammatory pathways. J Clin Endocrinol Metab. 2002;87:4231–7.7. Nelson SM, Matthews P, Poston L. Maternal metabolism and obesity:
modifiable determinants of pregnancy outcome. Hum Reprod Update.2010;16:255–75.
8. Ray JG, Diamond P, Singh G, Bell CM. Brief overview of maternal triglyceridesas a risk factor for pre-eclampsia. BJOG. 2006;113:379–86.
10. Bellamy L, Casas JP, Hingorani AD, Williams D. Type 2 diabetes mellitus aftergestational diabetes: a systematic review and meta-analysis. Lancet.2009;373:1773–9.
11. England LJ, Dietz PM, Njoroge T, Callaghan WM, Bruce C, Buus RM, WilliamsonDF. Preventing type 2 diabetes: public health implications for women with ahistory of gestational diabetes mellitus. Am J Obstet Gynecol. 2009;200:365–8.12. Sullivan SD, Umans JG, Ratner R. Gestational diabetes: implications for
cardiovascular health. Curr Diab Rep. 2012;12:43–52.
13. Reece EA. The fetal and maternal consequences of gestational diabetesmellitus. J Matern Fetal Neonatal Med. 2010;23:199–203.
14. Choi GY, Tosh DN, Garg A, Mansano R, Ross MG, Desai M. Gender-specificprogrammed hepatic lipid dysregulation in intrauterine growth-restrictedoffspring. Am J Obstet Gynecol. 2007;196:477.
15. Bruce KD, Cagampang FR, Argenton M, Zhang J, Ethirajan PL, Burdge GC,Bateman AC, Clough GF, Poston L, Hanson MA, McConnell JM, Byrne CD.Maternal high-fat feeding primes steatohepatitis in adult mice offspring,involving mitochondrial dysfunction and altered lipogenesis geneexpression. Hepatology. 2009;50:1796–808.
16. Srinivasan M, Katewa SD, Palaniyappan A, Pandya JD, Patel MS. Maternalhigh-fat diet consumption results in fetal malprogramming predisposing tothe onset of metabolic syndrome-like phenotype in adulthood. Am JPhysiol Endocrinol Metab. 2006;291:E792–9.
17. Szostak-Wegierek D. Intrauterine nutrition: long-term consequences forvascular health. Int J Womens Health. 2014;6:647–56. doi:10.2147/IJWH.S48751. eCollection@2014.: 647-656.
18. Practice Bulletin No. 137. Gestational diabetes mellitus. Obstet Gynecol.2013;122:406–16.
19. Giugliano D, De RN, Di MG, Marfella R, Acampora R, Buoninconti R, D’Onofrio F.Metformin improves glucose, lipid metabolism, and reduces blood pressure inhypertensive, obese women. Diabetes Care. 1993;16:1387–90.
20. Anurag P, Anuradha CV. Metformin improves lipid metabolism andattenuates lipid peroxidation in high fructose-fed rats. Diabetes ObesMetab. 2002;4:36–42.
21. Lin HZ, Yang SQ, Chuckaree C, Kuhajda F, Ronnet G, Diehl AM. Metforminreverses fatty liver disease in obese, leptin-deficient mice. Nat Med.2000;6:998–1003.
22. Charles B, Norris R, Xiao X, Hague W. Population pharmaco*kinetics ofmetformin in late pregnancy. Ther Drug Monit. 2006;28:67–72.23. Nanovskaya TN, Nekhayeva IA, Patrikeeva SL, Hankins GD, Ahmed MS.
Transfer of metformin across the dually perfused human placental lobule.Am J Obstet Gynecol. 2006;195:1081–5.
24. Desai N, Roman A, Rochelson B, Gupta M, Xue X, Chatterjee PK, Tam TH,Metz CN. Maternal metformin treatment decreases fetal inflammation in arat model of obesity and metabolic syndrome. Am J Obstet Gynecol.2013;209:136–9.
25. Holemans K, Caluwaerts S, Poston L, Van Assche FA. Diet-induced obesity inthe rat: a model for gestational diabetes mellitus. Am J Obstet Gynecol.2004;190:858–65.
26. Folch J, Lees M, Sloane Stanley GH. A simple method for the isolation andpurification of total lipides from animal tissues. J Biol Chem. 1957;226:497–509.27. Morrison WR, Smith lM. Preparation of fatty acid methyl esters and
dimethylacetals from lipids with boron fluoride–methanol. J Lipid Res.1964;5:600–8.
28. Gupta M, Solanki MH, Chatterjee PK, Xue X, Roman A, Desai N, Rochelson B,Metz CN. Maternal magnesium deficiency in mice leads to maternalmetabolic dysfunction and altered lipid metabolism with fetal growthrestriction. Mol Med. 2014;20:332–40.
29. Dowling O, Chatterjee PK, Gupta M, Tam Tam HB, Xue X, Lewis D, Rochelson B,Metz CN. Magnesium sulfate reduces bacterial LPS-induced inflammation atthe maternal-fetal interface. Placenta. 2012;33:392–8.
30. Cikos S, Bukovska A, Koppel J. Relative quantification of mRNA: comparisonof methods currently used for real-time PCR data analysis. BMC Mol Biol.2007;8:113–27.
31. Roman A, Desai N, Rochelson B, Gupta M, Solanki M, Xue X, Chatterjee PK,Metz CN. Maternal magnesium supplementation reduces intrauterinegrowth restriction and suppresses inflammation in a rat model. Am J ObstetGynecol. 2013;208:383–7.
32. Solanki MH, Chatterjee PK, Gupta M, Xue X, Plagov A, Metz MH, Mintz R,Singhal PC, Metz CN. Magnesium protects against cisplatin-induced acutekidney injury by regulating platinum accumulation. Am J Physiol RenalPhysiol. 2014;307:F369–84.
33. Innis SM. Perinatal biochemistry and physiology of long-chainpolyunsaturated fatty acids. J Pediatr. 2003;143:S1–8.
34. Coti BP, O’Kusky JR, Innis SM. Maternal dietary (n-3) fatty acid deficiencyalters neurogenesis in the embryonic rat brain. J Nutr. 2006;136:1570–5.35. Westermeier F, Saez PJ, Villalobos-Labra R, Sobrevia L, and Farias-Jofre M.
Programming of fetal insulin resistance in pregnancies with maternalobesity by ER stress and inflammation. Biomed Res Int. 2014;917672.doi: 10.1155/2014/917672
36. Horton JD, Goldstein JL, Brown MS. SREBPs: activators of the completeprogram of cholesterol and fatty acid synthesis in the liver. J Clin Invest.2002;109:1125–31.
37. Horton JD, Shah NA, Warrington JA, Anderson NN, Park SW, Brown MS,Goldstein JL. Combined analysis of oligonucleotide microarray data fromtransgenic and knockout mice identifies direct SREBP target genes. ProcNatl Acad Sci U S A. 2003;100:12027–32.
38. Shimano H, Horton JD, Shimomura I, Hammer RE, Brown MS, Goldstein JL.Isoform 1c of sterol regulatory element binding protein is less active thanisoform 1a in livers of transgenic mice and in cultured cells. J Clin Invest.1997;99:846–54.
39. Wiernsperger N. Hepatic function and the cardiometabolic syndrome.Diabetes Metab Syndr Obes. 2013;6:379–88. doi:10.2147/DMSO.S51145.40. Lewis GF, Carpentier A, Adeli K, Giacca A. Disordered fat storage and
mobilization in the pathogenesis of insulin resistance and type 2 diabetes.Endocr Rev. 2002;23:201–29.
41. Heerwagen MJ, Miller MR, Barbour LA, Friedman JE. Maternal obesity andfetal metabolic programming: a fertile epigenetic soil. Am J Physiol RegulIntegr Comp Physiol. 2010;299:R711–22.
42. McCurdy CE, Bishop JM, Williams SM, Grayson BE, Smith MS, Friedman JE,Grove KL. Maternal high-fat diet triggers lipotoxicity in the fetal livers ofnonhuman primates. J Clin Invest. 2009;119:323–35.
43. Kaneda M, Kashiwamura S, Ueda H, Sawada K, Sugihara A, Terada N, Kimura-Shimmyo A, f*ckuda Y, Shimoyama T, Okamura H. Inflammatory liver steatosiscaused by IL-12 and IL-18. J Interferon Cytokine Res. 2003;23:155–62.44. Marchesini G, Brizi M, Morselli-Labate AM, Bianchi G, Bugianesi E,
McCullough AJ, Forlani G, Melchionda N. Association of nonalcoholic fattyliver disease with insulin resistance. Am J Med. 1999;107:450–5.45. Crowther CA, Hiller JE, Moss JR, McPhee AJ, Jeffries WS, Robinson JS. Effect
of treatment of gestational diabetes mellitus on pregnancy outcomes.N Engl J Med. 2005;352:2477–86.
46. Helvaci MR, Kaya H, Borazan A, Ozer C, Seyhanli M, Yalcin A. Metformin andparameters of physical health. Intern Med. 2008;47:697–703.
47. Smith AC, Mullen KL, Junkin KA, Nickerson J, Chabowski A, Bonen A, Dyck DJ.Metformin and exercise reduce muscle FAT/CD36 and lipid accumulation andblunt the progression of high-fat diet-induced hyperglycemia. Am J PhysiolEndocrinol Metab. 2007;293:E172–81.
48. Coetzee EJ, Jackson WP. Metformin in management of pregnant insulin-independent diabetics. Diabetologia. 1979;16:241–5.
49. Rowan JA, Hague WM, Gao W, Battin MR, Moore MP. Metformin versusinsulin for the treatment of gestational diabetes. N Engl J Med.2008;358:2003–15.
50. Charlton RA, Klungsoyr K, Neville AJ, Jordan S, Pierini A, de Jong-van denBerg LT, Bos HJ, Puccini A, Engeland A, Gini R, Davies G, Thayer D, HansenAV, Morgan M, Wang H, McGrogan A, Nybo Andersen AM, Dolk H, Garne E.Prescribing of antidiabetic medicines before, during and after pregnancy:a study in seven European regions. PLoS ONE. 2016;11:e0155737.51. Nicholson W, Bolen S, Witkop CT, Neale D, Wilson L, Bass E. Benefits and risks
of oral diabetes agents compared with insulin in women with gestationaldiabetes: a systematic review. Obstet Gynecol. 2009;113:193–205.52. Zhu B, Zhang L, Fan YY, Wang L, Li XG, Liu T, Cao YS, Zhao ZG. Metformin
versus insulin in gestational diabetes mellitus: a meta-analysis ofrandomized clinical trials. Ir J Med Sci. 2016;185:371–81.
53. Barrett HL, Dekker NM, Jones L, O’Rourke P, Lust K, Gatford KL, De Blasio MJ,Coat S, Owens JA, Hague WM, McIntyre HD, Callaway L, Rowan J.Determinants of maternal triglycerides in women with gestationaldiabetes mellitus in the Metformin in Gestational Diabetes (MiG) study.Diabetes Care. 2013;36:1941–6.
54. Kita Y, Takamura T, Misu H, Ota T, Kurita S, Takesh*ta Y, Uno M, Matsuzawa-Nagata N, Kato K, Ando H, Fujimura A, Hayashi K, Kimura T, Ni Y, Otoda T,Miyamoto K, Zen Y, Nakanuma Y, Kaneko S. Metformin prevents andreverses inflammation in a non-diabetic mouse model of nonalcoholicsteatohepatitis. PLoS ONE. 2012;7:e43056.
55. Algire C, Amrein L, Zakikhani M, Panasci L, Pollak M. Metformin blocks thestimulative effect of a high-energy diet on colon carcinoma growth in vivoand is associated with reduced expression of fatty acid synthase. EndocrRelat Cancer. 2010;17:351–60.
56. Zawiejska A, Wender-Ozegowska E, Grewling-Szmit K, Brazert M, Brazert J.Short-term antidiabetic treatment with insulin or metformin has a similarimpact on the components of metabolic syndrome in women withgestational diabetes mellitus requiring antidiabetic agents. Results of aprospective, randomised study. J Physiol Pharmacol. 2016;67:227–33.57. Salomaki H, Vahatalo LH, Laurila K, Jappinen NT, Penttinen AM, Ailanen L,
Ilyasizadeh J, Pesonen U, Koulu M. Prenatal metformin exposure in miceprograms the metabolic phenotype of the offspring during a high fat dietat adulthood. PLoS ONE. 2013;8:e56594.
58. Koh SJ, Kim JM, Kim IK, Ko SH, Kim JS. Anti-inflammatory mechanism ofmetformin and its effects in intestinal inflammation and colitis-associatedcolon cancer. J Gastroenterol Hepatol. 2014;29:502–10.
59. Isoda K, Young JL, Zirlik A, MacFarlane LA, Tsuboi N, Gerdes N, Schonbeck U,Libby P. Metformin inhibits proinflammatory responses and nuclear factor-kappaB in human vascular wall cells. Arterioscler Thromb Vasc Biol.2006;26:611–7.
60. Tertti K, Eskola E, Ronnemaa T, Haataja L. Neurodevelopment of two-year-old children exposed to metformin and insulin in gestational diabetesmellitus. J Dev Behav Pediatr. 2015;36:752–7.
61. Wouldes TA, Battin M, Coat S, Rush EC, Hague WM, Rowan JA.Neurodevelopmental outcome at 2 years in offspring of womenrandomised to metformin or insulin treatment for gestational diabetes.Arch Dis Child Fetal Neonatal Ed. 2016. fetalneonatal-309602
62. Salomäki H, Heinäniemi M, Vähätalo LH, Ailanen L, Eerola K, Ruohonen ST,Pesonen U, Koulu M. Prenatal metformin exposure in a maternal high fatdiet mouse model alters the transcriptome and modifies themetabolic responses of the offspring. PLoS One. 2014;9:e115778.doi:10.1371/journal.pone.0115778.
63. Ferrara A. Increasing prevalence of gestational diabetes mellitus. a publichealth perspective. Diabetes Care. 2007;30 Suppl 2:S141–6.
• We accept pre-submission inquiries
• Our selector tool helps you to find the most relevant journal
• We provide round the clock customer support
• Convenient online submission
• Thorough peer review
• Inclusion in PubMed and all major indexing services
• Maximum visibility for your research
Submit your manuscript atwww.biomedcentral.com/submit
